Alvin20 Alvin20
  • 03-05-2015
  • History
contestada

With which of these positions would President Calvin Coolidge have agreed?

Respuesta :

HistoryGuy HistoryGuy
  • 13-05-2015
Assuming this is the same list that was posted before, Calvin Coolidge agreed that the government should be fairly "hands off" when it cam to economic policy.
Answer Link

Otras preguntas

is a centimeter one tenth or one hundredth or a meter
how do i find the angles on a kite?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
a summary about concussions
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
what are the 2 major types of cofactors?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?