flygirlangel123 flygirlangel123

03-04-2017
Mathematics

contestada

What is the mode and range of 45 50 47 52 53 45 51

Respuesta :

meganlaney1 meganlaney1

03-04-2017

mode : 50.1 and range is 8

Answer Link

Jay0111 Jay0111

03-04-2017

Mode is 45 not 51. A mode is the number that appears most often in a set of numbers and 45 appears twice

Answer Link

Otras preguntas

In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.

PLEASE HELP ASAP what is the correct product of (7x - 3)(7x + 3).49x^2 + 949x^2 - 42x + 9 49x^2 - 949x^2 + 42x + 9

a school cafeteria makes 4 diffrent salads during the week but serves only 2 salads each day on a roating basis. salads: chicken,fruit,pasta,tuna. a student ran

what played a great role in the kansan nebraska act

If the points (-2, 2), (-4, 4), (2, -2), and (4, -4) are joined to form a straight line, at what point does the line intersect the y-axis

What caused the gross domestic product of the united states to quadruple between 1860 and 1890?

What is the slope of the line that contains the points (10,-3) and (8,-9)?

From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.

Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat