kelbear7692 kelbear7692
  • 01-08-2022
  • Mathematics
contestada

Given the system of equations, what is the solution? x 2y = 11 x - 2y = -1 {(-5, -3)} {(1, 1)} {(5, 3)}

Respuesta :

profarouk profarouk
  • 12-08-2022

Answer:

{(5, 3)}

Step-by-step explanation:

Consider the system :

x + 2y = 11

x - 2y = -1

We notice that :

5 + 2×3 = 11

5 - 2×3 = -1

We conclude that :

(5, 3) is the solution to the system.

Answer Link

Otras preguntas

20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
how to i do 7/16÷(31/2÷1/2)
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Do all your pet's offspring look the same? If no, then explain why they look different.
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place