teenzobot24 teenzobot24
  • 02-12-2021
  • Arts
contestada

_____ imagery often resembles that of an uncanny dream world, rife with sexuality and violence. A. Futurist B. Dadaist C. Constructivist D. Surrealist

Respuesta :

23amazingallie 23amazingallie
  • 02-12-2021
Surrealist is the correct answer. Surrealism refers to a dream world.
Answer Link

Otras preguntas

How many years does an apple tree live useful?
3+1/4x greater than 11
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
how would u form a superlative for the adverb widely
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
Where did middle names come from
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10