chin160179 chin160179

04-08-2021
Mathematics

contestada

Help anyone can help me do this question,I will mark brainlest.

Help anyone can help me do this questionI will mark brainlest class=

Respuesta :

aidencristy8g aidencristy8g

04-08-2021

Answer:

1) x=6, 2) x=13

Step-by-step explanation:

Ver imagen aidencristy8g

Answer Link

Otras preguntas

Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in

what is the relationship between hitech and hipaa

Help me please im about to give up

(60) Points HeLp asap 5 questions

What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome

What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36

When Anne begins to think about a boy friend, someone in turn drives her to think about Peter van Daan. Who? Peter Wessel Miep de Jong Harry Goldberg