leahlit leahlit
  • 01-12-2016
  • History
contestada

What European industries Benefited from African resources

Respuesta :

metchelle
metchelle metchelle
  • 05-12-2016
Here is the answer of the given question above. The European industries that benefitted from African resources include Fabrics, soap, candles, clothes, tires, handles, instruments, billiard balls, coins metal alloys electrical wiring, ammunition, jewelry, tools, rope and twine. These are all the industries in Europe that benefited from the African resources. Hope this answer helps.
Answer Link

Otras preguntas

Is 5/7 greater than 4/6
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Companies raise funds to expand their business by
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
the reproductive system of a male mammal provides
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo