dolahmohamed55 dolahmohamed55

02-03-2021
Computers and Technology

contestada

Emanuel studies hard for hours on end until bedtime, yet his grades could be better. What can he do to improve his academic performance?

sleep less
take breaks
eat more
work longer

Respuesta :

aleyna88 aleyna88

02-03-2021

Emanuel needs to Take breaks

Answer Link

xilyyshxyy xilyyshxyy

13-02-2022

Answer:

Its B! I know I'm late but for the other people that might get the same question like me.

Answer Link

Otras preguntas

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s

How many positive odd integers less than 300 can be formed using the digits 0, 1,2,3,4?

The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti

What factors can affect mental health

What was the result of the anti-nephi-lehies becoming converted unto the lord?

Suppose that a particular artillery piece has a range r = 5710 yards . find its range in miles. use the facts that 1mile=5280ft and 3ft=1yard

Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho

The wealth and prosperity of mali and songhai were dependent on controlling the trade in

An important change in the american family in the nineteenth century was

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat