kellenbreannn
kellenbreannn kellenbreannn
  • 01-09-2020
  • Biology
contestada

Give one example of how the testing of Platismatia glauca could benefit future ecological research of this forest.

Respuesta :

jacieweger jacieweger
  • 08-09-2020

Answer:

Testing Platismatia glauca could help scientists understand which pollutants have the largest effect on lichen populations. It also may help scientists understand the current pollutant levels in the atmosphere compared to the population of lichens on the trees. This information can help them more accurately predict population changes over time.

hope this helps:)

Answer Link

Otras preguntas

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
How well did feudalism establish order in the Middle ages?
what rule does static electricity follow
Fossils are most commonly found in which type of rock?
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l