mirandaahrens
mirandaahrens mirandaahrens
  • 02-03-2020
  • Mathematics
contestada

What is the answer to 0.38 × 10³

Respuesta :

Onoriodefelix
Onoriodefelix Onoriodefelix
  • 02-03-2020

Answer:

380

Step-by-step explanation:

Given

0.38 x 10^3

10^3 = 10 x 10 x 10

= 1000

Therefore

0.38 x 1000 =380

Answer Link

Otras preguntas

the height h in feet of a projectile launched upward at a speed of 32 feet/ second from a height of 48 feet is given by the function : h(t) =16^2+32t +48. how l
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What allows small vertical movements to grow until they produce turbulent airflow?
Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?
Groups that are more formal and require less continuous interaction are known as what type of​ group?
what is the sum of odd positive integers less than 50
Which of the following shows the graph of y=In(-2x)
show work and factor ?
You should always wear your seatbelt just in case the car comes to an abrupt stop. The seatbelt will hold you in place so that your body does not continue movin
How many significant figures are there is the numerical value: 0.00019?