bananaone6125 bananaone6125
  • 03-07-2018
  • History
contestada

What was the invention of the steam engine important to the agriculture revolution and later the industrial revolution?

Respuesta :

Daud2020 Daud2020
  • 03-07-2018
Steam engine was one of the most important thing for Industrial revolution to spread cause it only made it possible to make more and more good than people used to make by hands.
Answer Link

Otras preguntas

what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
accurate estimation 719-348
how would u form a superlative for the adverb widely
31+34=90-n 45+1=70-k 6×9=41+m
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what are the 2 major types of cofactors?
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.